ID: 1004506183_1004506189

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1004506183 1004506189
Species Human (GRCh38) Human (GRCh38)
Location 6:16248732-16248754 6:16248779-16248801
Sequence CCCTTTCCCTGCTCTGCTCTGTC ATGTGTTAGTATAAAAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 105, 4: 904} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!