ID: 1004750261_1004750265

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1004750261 1004750265
Species Human (GRCh38) Human (GRCh38)
Location 6:18555191-18555213 6:18555239-18555261
Sequence CCTGGTGGTGCAGAAATATAATC ATGGAAAGGCAGAATGACAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 44, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!