ID: 1005002970_1005002975

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1005002970 1005002975
Species Human (GRCh38) Human (GRCh38)
Location 6:21261283-21261305 6:21261302-21261324
Sequence CCTTTAATTACATTAGCTAAAGA AAGAAGAAGGAGGAGGAGGAAGG
Strand - +
Off-target summary No data {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!