ID: 1005036290_1005036298

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1005036290 1005036298
Species Human (GRCh38) Human (GRCh38)
Location 6:21558104-21558126 6:21558143-21558165
Sequence CCCAAAATTCATATATGGAAACC GATGTTAGGAAGTGGGGATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 47, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!