ID: 1005039739_1005039744

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1005039739 1005039744
Species Human (GRCh38) Human (GRCh38)
Location 6:21589961-21589983 6:21589995-21590017
Sequence CCAAAAAAACTGGCGCCTTTCAG CAATGACATCAGATTTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!