ID: 1005072459_1005072461

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1005072459 1005072461
Species Human (GRCh38) Human (GRCh38)
Location 6:21874451-21874473 6:21874466-21874488
Sequence CCTGGAAACAGACTCGGGGCTGT GGGGCTGTTTCCAGATATCAGGG
Strand - +
Off-target summary {0: 16, 1: 106, 2: 195, 3: 242, 4: 399} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!