ID: 1005119772_1005119775

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1005119772 1005119775
Species Human (GRCh38) Human (GRCh38)
Location 6:22377245-22377267 6:22377266-22377288
Sequence CCATGCCTATGTCCTTAATGGTA TATTGCCTGAGTTTTCTTCTAGG
Strand - +
Off-target summary No data {0: 4, 1: 339, 2: 9166, 3: 11317, 4: 5131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!