ID: 1005121095_1005121099

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1005121095 1005121099
Species Human (GRCh38) Human (GRCh38)
Location 6:22389987-22390009 6:22390031-22390053
Sequence CCGGGAGCTTGGCAGGCTTAGGC TGAGAATCTGCGCAGCTCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!