ID: 1005209115_1005209116

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1005209115 1005209116
Species Human (GRCh38) Human (GRCh38)
Location 6:23440561-23440583 6:23440598-23440620
Sequence CCTTTTTTTTTTTTTTTTTTTTT TCCACCCAACTCCACATTTTAGG
Strand - +
Off-target summary {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!