ID: 1005298899_1005298903

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1005298899 1005298903
Species Human (GRCh38) Human (GRCh38)
Location 6:24451927-24451949 6:24451941-24451963
Sequence CCGGCCCTCCTACGGGCCAGCCA GGCCAGCCAGTCATTCCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!