ID: 1005456184_1005456192

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1005456184 1005456192
Species Human (GRCh38) Human (GRCh38)
Location 6:26021783-26021805 6:26021827-26021849
Sequence CCGGCGTCTGGCCCGGCGTGGCG TGATCTACGAGGAGACTCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167} {0: 1, 1: 3, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!