ID: 1005470269_1005470277

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1005470269 1005470277
Species Human (GRCh38) Human (GRCh38)
Location 6:26156428-26156450 6:26156459-26156481
Sequence CCCCTGCCGAGAAGACTCCCGTG GGCCCGCAAGTCTGCAGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 104} {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!