ID: 1005473922_1005473925

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1005473922 1005473925
Species Human (GRCh38) Human (GRCh38)
Location 6:26188931-26188953 6:26188947-26188969
Sequence CCAGAAATACGCTTGACGCCGCC CGCCGCCGCGGCGAGCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 15} {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!