ID: 1005475610_1005475619

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1005475610 1005475619
Species Human (GRCh38) Human (GRCh38)
Location 6:26204736-26204758 6:26204768-26204790
Sequence CCAAGCCTGCCATCCGGCGCCTT GGGGGTGTCAAGCGCATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 9, 4: 115} {0: 1, 1: 1, 2: 2, 3: 9, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!