ID: 1005475611_1005475619

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1005475611 1005475619
Species Human (GRCh38) Human (GRCh38)
Location 6:26204741-26204763 6:26204768-26204790
Sequence CCTGCCATCCGGCGCCTTGCTCG GGGGGTGTCAAGCGCATTTCTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 1, 3: 12, 4: 131} {0: 1, 1: 1, 2: 2, 3: 9, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!