ID: 1005575777_1005575783

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1005575777 1005575783
Species Human (GRCh38) Human (GRCh38)
Location 6:27188024-27188046 6:27188039-27188061
Sequence CCGGACTTTAGGTACCCTAAGGG CCTAAGGGTGGTATTGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 24, 3: 33, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!