ID: 1005649457_1005649462

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1005649457 1005649462
Species Human (GRCh38) Human (GRCh38)
Location 6:27873365-27873387 6:27873388-27873410
Sequence CCTGAGATGCGCTTAACGCCTCC ACGCCGTGCCAGGCGTCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 38} {0: 1, 1: 0, 2: 1, 3: 1, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!