ID: 1005710984_1005710994

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1005710984 1005710994
Species Human (GRCh38) Human (GRCh38)
Location 6:28502583-28502605 6:28502619-28502641
Sequence CCCTCTGCTCGGCCGCCACGCCG CCCAACAGCTCATTGAGAACGGG
Strand - +
Off-target summary No data {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!