ID: 1005710984_1005710996

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1005710984 1005710996
Species Human (GRCh38) Human (GRCh38)
Location 6:28502583-28502605 6:28502634-28502656
Sequence CCCTCTGCTCGGCCGCCACGCCG AGAACGGGCCATGATGACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 206, 3: 1193, 4: 1223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!