ID: 1005845392_1005845397

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1005845392 1005845397
Species Human (GRCh38) Human (GRCh38)
Location 6:29772876-29772898 6:29772897-29772919
Sequence CCTTTCCCAGGGTAACCTGCCTC TCCGTTGCTATATCTCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 17, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!