ID: 1005953512_1005953523

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1005953512 1005953523
Species Human (GRCh38) Human (GRCh38)
Location 6:30647832-30647854 6:30647872-30647894
Sequence CCATCGGGGACCGAGGTACCCGA CCTGCAGTGAGACGATCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21} {0: 1, 1: 1, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!