|
Left Crispr |
Right Crispr |
| Crispr ID |
1006024206 |
1006024208 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:31137140-31137162
|
6:31137158-31137180
|
| Sequence |
CCGTCTAAAAAAAAAAGAAAGAA |
AAGAAAAAGAAGAAAGAGGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 33, 1: 664, 2: 8439, 3: 103037, 4: 93910} |
{0: 1, 1: 7, 2: 104, 3: 1319, 4: 9000} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|