ID: 1006054944_1006054956

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006054944 1006054956
Species Human (GRCh38) Human (GRCh38)
Location 6:31377414-31377436 6:31377463-31377485
Sequence CCCTGGCCTGTACCCTAGTGCTT ACTTCTGATCCCCTAGGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131} {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!