ID: 1006054948_1006054960

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006054948 1006054960
Species Human (GRCh38) Human (GRCh38)
Location 6:31377426-31377448 6:31377477-31377499
Sequence CCCTAGTGCTTTGTATGGCTGTG AGGACTGGGAGCAGCCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 164} {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!