ID: 1006054959_1006054968

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006054959 1006054968
Species Human (GRCh38) Human (GRCh38)
Location 6:31377474-31377496 6:31377501-31377523
Sequence CCTAGGACTGGGAGCAGCCCGCC GGAGACCATCAGGATGTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 620} {0: 1, 1: 0, 2: 1, 3: 27, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!