ID: 1006054959_1006054969

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006054959 1006054969
Species Human (GRCh38) Human (GRCh38)
Location 6:31377474-31377496 6:31377505-31377527
Sequence CCTAGGACTGGGAGCAGCCCGCC ACCATCAGGATGTCTATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 620} {0: 1, 1: 0, 2: 1, 3: 25, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!