ID: 1006059797_1006059803

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006059797 1006059803
Species Human (GRCh38) Human (GRCh38)
Location 6:31411577-31411599 6:31411591-31411613
Sequence CCTCCGACAGAATCCTGAGCCTG CTGAGCCTGTGGTGGGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 119} {0: 1, 1: 1, 2: 4, 3: 43, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!