ID: 1006059797_1006059804

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1006059797 1006059804
Species Human (GRCh38) Human (GRCh38)
Location 6:31411577-31411599 6:31411595-31411617
Sequence CCTCCGACAGAATCCTGAGCCTG GCCTGTGGTGGGTGTCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 119} {0: 1, 1: 0, 2: 3, 3: 37, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!