ID: 1006115951_1006115966

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1006115951 1006115966
Species Human (GRCh38) Human (GRCh38)
Location 6:31776349-31776371 6:31776399-31776421
Sequence CCCCACAAAGGAGGGACAGTCCC ATTTCAGGACCAAGACTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159} {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!