ID: 1006189775_1006189782

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006189775 1006189782
Species Human (GRCh38) Human (GRCh38)
Location 6:32200836-32200858 6:32200864-32200886
Sequence CCTGCATGAGGGTGGACAGCCAG GTCCAGGCAGCAGGGGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236} {0: 1, 1: 0, 2: 1, 3: 48, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!