ID: 1006283520_1006283529

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1006283520 1006283529
Species Human (GRCh38) Human (GRCh38)
Location 6:33076122-33076144 6:33076159-33076181
Sequence CCAGGGCAGGGCCACTCCAGGTA ATTCTTGGAGGGTCTGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 294} {0: 1, 1: 1, 2: 0, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!