ID: 1006290665_1006290670

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006290665 1006290670
Species Human (GRCh38) Human (GRCh38)
Location 6:33133627-33133649 6:33133669-33133691
Sequence CCTGTTTTACTCCAAATCATGGT ATGCCCTTCTAGAAGACTGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 20, 2: 53, 3: 45, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!