ID: 1006301621_1006301630

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006301621 1006301630
Species Human (GRCh38) Human (GRCh38)
Location 6:33196457-33196479 6:33196493-33196515
Sequence CCCCAGGACCCTCAACGCCCTGG CCACAGCAAGCTCTGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205} {0: 2, 1: 161, 2: 13899, 3: 98792, 4: 125071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!