ID: 1006351123_1006351131

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1006351123 1006351131
Species Human (GRCh38) Human (GRCh38)
Location 6:33521804-33521826 6:33521826-33521848
Sequence CCGAGCCCGCGCCCACCCGGAAC CTCGAGCTGGCGCGCAGCCCTGG
Strand - +
Off-target summary {0: 11, 1: 673, 2: 708, 3: 400, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!