ID: 1006395088_1006395096

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1006395088 1006395096
Species Human (GRCh38) Human (GRCh38)
Location 6:33782051-33782073 6:33782089-33782111
Sequence CCTGTCGCCTTCCCCTAACACAG TCAAAGTTGATCTTGACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131} {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!