ID: 1006412219_1006412224

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1006412219 1006412224
Species Human (GRCh38) Human (GRCh38)
Location 6:33880710-33880732 6:33880731-33880753
Sequence CCCACAATTTAGCCTAAATATTT TTGTCCTGGGTTGCTTATACTGG
Strand - +
Off-target summary {0: 158, 1: 96, 2: 33, 3: 40, 4: 360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!