ID: 1006412220_1006412224

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1006412220 1006412224
Species Human (GRCh38) Human (GRCh38)
Location 6:33880711-33880733 6:33880731-33880753
Sequence CCACAATTTAGCCTAAATATTTG TTGTCCTGGGTTGCTTATACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 142, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!