ID: 1006510482_1006510487

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1006510482 1006510487
Species Human (GRCh38) Human (GRCh38)
Location 6:34518632-34518654 6:34518665-34518687
Sequence CCCGCTGGAGAGCTCTGGGAGGG CACCTTTGACTCAGTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!