ID: 1006632002_1006632015

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006632002 1006632015
Species Human (GRCh38) Human (GRCh38)
Location 6:35436566-35436588 6:35436585-35436607
Sequence CCCTCCATGCCTCCCACCAGCAG GCAGGCCTGGGGCCATGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 89, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!