ID: 1006672378_1006672389

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1006672378 1006672389
Species Human (GRCh38) Human (GRCh38)
Location 6:35737394-35737416 6:35737435-35737457
Sequence CCATCTTCCTCAAGCCCACCCTG CCTGCCAGAGATGCTAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 545} {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!