ID: 1006672386_1006672392

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1006672386 1006672392
Species Human (GRCh38) Human (GRCh38)
Location 6:35737423-35737445 6:35737443-35737465
Sequence CCTAGGCAAGGCCCTGCCAGAGA AGATGCTAGCTCAGGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 277} {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!