ID: 1006790372_1006790379

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006790372 1006790379
Species Human (GRCh38) Human (GRCh38)
Location 6:36697472-36697494 6:36697508-36697530
Sequence CCATACACTTAGCTTCAGCCACG ACCTGCTGCTGTCTGGGATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!