ID: 1006824795_1006824799

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006824795 1006824799
Species Human (GRCh38) Human (GRCh38)
Location 6:36926838-36926860 6:36926887-36926909
Sequence CCTGCGGCATCACGGCATGGTGC GACTCAGATGTGCCTCCGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51} {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!