ID: 1006915242_1006915252

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006915242 1006915252
Species Human (GRCh38) Human (GRCh38)
Location 6:37589726-37589748 6:37589761-37589783
Sequence CCTTAATTCTGCAGATCCCCTCC GGGCTCCGCAAGCTCCATGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!