ID: 1006929555_1006929560

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1006929555 1006929560
Species Human (GRCh38) Human (GRCh38)
Location 6:37679565-37679587 6:37679598-37679620
Sequence CCCGATATTGTGACACGTGCCTG CTCCCATGCCGCCTCCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 41, 3: 821, 4: 7980} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!