ID: 1007179967_1007179982

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1007179967 1007179982
Species Human (GRCh38) Human (GRCh38)
Location 6:39922914-39922936 6:39922967-39922989
Sequence CCCATCCCTCCTTCCTCCACCAG TTGCTCTGAAGCAGCTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 830} {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!