ID: 1007179980_1007179982

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007179980 1007179982
Species Human (GRCh38) Human (GRCh38)
Location 6:39922952-39922974 6:39922967-39922989
Sequence CCCTTCAAGGCTGCTTTGCTCTG TTGCTCTGAAGCAGCTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211} {0: 1, 1: 0, 2: 1, 3: 22, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!