ID: 1007198258_1007198272

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1007198258 1007198272
Species Human (GRCh38) Human (GRCh38)
Location 6:40082407-40082429 6:40082446-40082468
Sequence CCAGAGAAGAATCTTTCTACCCA CACCTGGGACCACTCTCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!