ID: 1007252424_1007252426

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007252424 1007252426
Species Human (GRCh38) Human (GRCh38)
Location 6:40505046-40505068 6:40505061-40505083
Sequence CCTAGATCTTTGGAGGGGACAGT GGGACAGTTGCCCGTGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 121} {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!