ID: 1007345637_1007345645

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1007345637 1007345645
Species Human (GRCh38) Human (GRCh38)
Location 6:41227846-41227868 6:41227892-41227914
Sequence CCCACCATTTCCAGGGAACATCT GCCCTCTACAAAATGTCTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!